Validation experiment with the reporter virus
One vector system containing both Cas9 and sgRNA was used to make the KO
lentivirus to disrupt the genes in both ACE2 293T cells and
ACE2-293T-Cre reporter cells. The one vector system LentiCRISPR v2 was a
gift from Brett Stringer (Addgene plasmid #98290). The following sgRNA
sequences were used for the validation experiment- ACE2
(AACATCTTCATGCCTATGTG), SLC35B2 (GCACTCGGTTCATTAGCACC), HSP90B1
(AGACCACGTGGAGCAGATGT), EP300 (ATGGTGAACCATAAGGATTG), NT control
(ACAGCCCTCACGAGCCCGAA). The reporter viruses were made following the
same procedure that was followed to make reporter virus for the whole
genome screening. The mutants were transduced with reporter viruses and
incubated for 48 hours. After 48 hours of incubation the cells were run
through flow cytometer to measure the infection.