DNA Isolation and Conventional PCR Assay
Cultures of isolates were incubated in LB overnight at 30 °C and DNA was
extracted according to Carozzi et al. (1991).
The oligonucleotide primers used in the study were as follows (5’→3’):
GTTATTCTTAATGCAGATGAATGGG, CGGATAAAATAATCTGGGAAATAGT.
The test tube for PCR was filled with 1 ml of a solution containing 10
pmol of a primer for cry2 and 2 ml of DNA. The PCR conditions:
- denaturation (95 °C, 5 min, 1 cycle);
- denaturation (95 °C, 30 sec, 35 cycles);
- annealing (55 °C, 30 sec, 1 cycle);
- elongation (72 °C, 6 min, 1 cycle).
After amplification, an agar gel solution (1.5%) was used for gel
electrophoresis and identification.