DNA Isolation and Conventional PCR Assay
Cultures of isolates were incubated in LB overnight at 30 °C and DNA was extracted according to Carozzi et al. (1991).
The oligonucleotide primers used in the study were as follows (5’→3’):
GTTATTCTTAATGCAGATGAATGGG, CGGATAAAATAATCTGGGAAATAGT.
The test tube for PCR was filled with 1 ml of a solution containing 10 pmol of a primer for cry2 and 2 ml of DNA. The PCR conditions:
After amplification, an agar gel solution (1.5%) was used for gel electrophoresis and identification.