2.1 Transgenic mice
The APPswe/PSEN1dE9 (APP/PS1) transgenic mice co-expressing human APPSwe and PS1-dE9 mutations with C57BL/6 background, were purchased from the Jackson Laboratory. The transgenic mice overexpressing human Lf (GenBank: BC015822.1) in astrocytes (Astro-Lf mice) in a background of C57BL/6 were generated by Cyagen Biosciences Inc. In brief, the pRP.ExBi-GFAP-Lf plasmid with GFAP promotor-driven human Lf cDNA expression was injected into the male pronucleus of fertilized eggs of C57BL/6 mice, the fertilized eggs were then transferred into the fallopian tube of pseudopregnant female mice to construct and screen the Astro-Lf mice. The Astro-Lf mice were crossed with the APP/PS1 mice to obtain the APP/PS1 mice with astrocytes overexpressing human Lf (APP/PS1/Lf mice). The DNA from tail biopsies were submitted to the polymerase chain reaction (PCR) to identify the different genotype mice. The following primers were used: Lf (human): forward, ATCGCCAGTCTAGCCCACTC and reverse, TCTCTTTATGCAGCTGACAGGA; Internal control: forward, ACTCCAAGGCCACTTATCACC and reverse, ATTGTTACCAACTGGGACGACA. All the mice were housed in cages with free access to a standard diet and distilled water under standard conditions (24 ℃, 12 h light-dark cycle). Male mice at the age of 10 months old were submitted to animal behavioral tests and sacrificed for the biochemical analyses.