2.2. pre-LASSO probes
The pre-LASSO probes were 158-bp long. The E.coli pre-LASSO probe library was purchased as ssDNA oligo pool from Twist Bioscience. The positive control pre-LASSO 1kbM13 was obtained from IDT ad as dDNA (gBlock). The DNA sequences of pre-LASSO 1kbM13 is available in (Supplementary Table 2 ). The ssDNA Twist oligo pool (20 ng) was PCR amplified using selector primers Sap1F and BamH1R. The PCR was performed in a 25µl of 1X Kapa Hi Fidelity Buffer with pre-LASSO probe library (4ng), dNTPS (0.3 mM) and 0.5 units of Kapa Taq DNA polymerase, and Selector primers (0.3 µM) aF. The PCR thermal cycle was 3min at 95°C, ( 98°C for 20 sec, 58°C for 15 sec, 1 min at 72°C) for 8 cycles. The correct size of the amplicon (~160bp) was verified by loading 3 µl of the PCR volume on a 2% agarose gel with ethidium bromide and using Low Molecular Weight Ladder as reference . For the single pre-LASSO probe 1kbM13 and for the 3,108 E. coli K12 ORF pre-LASSO library subpool, the design was: 5´ CAGACGACGGCCAGTGTCGAC,Ligation Arm, AACACTTCTTGCGGCGATGGTTCCTGGCTCTTCGATC, Extension Arm, GGATCCTACGGTCATTCAGC 3´
The ORFs of the E. coli K12 genome that were longer than 400 nucleotides were targeted with ligation and extension arms positioned at the beginning and end of the sequences, respectively, and extended until the desired melting temperature was reached. Specifically, the algorithm first selected the ORFs leading and trailing 32-nucleotide sequences for the two arms at melting temperatures for the ligation and extension arms of between 65 °C and 85 °C and 55 °C and 80 °C, respectively. If at least one of these conditions were not satisfied, the algorithm increased the length of the arms by one nucleotide and re-tested the conditions until they were satisfied or until the end of the ORF was reached. Because probes had non-homogeneous lengths (depending on the Tm of ligation and extension arms) up to a maximum length of 158bp, we extended all probes to 158bp by adding random oligonucleotides in between the primer selector annealing site and the extension arm.
Since a SwaI digestion step was used to assemble the LASSO probes, the algorithm discarded the design of pre-LASSO probes where a Swa1 restriction site was present in the ligation or extension arm. A full list of the 3089 ORFs with valid ligation and extension arms and their corresponding pre-LASSO probes is reported in the Supplementary Table 2 .