Quantitative real-time polymerase chain reaction (qRT–PCR),
Western blotting, ChIP and ELISA
qRT–PCR was performed using the ABI StepOnePlusTMReal-time PCR system (Applied Biosystem) with specific primers (Table
1). The relative mRNA level of target genes was analyzed using the
equation 2–ΔCt (ΔCt = Ct of the target gene – Ct of β-actin) and
normalized using the level detected in the control group as 1. Western
blotting experiments were performed using antibodies for FXR, LXR, and
PPARγ etc., as described
previously[22].
ChIP was performed as
described[21]. ChIP
was done using specifc antibodies for NF-κB p65 (Abcam, cat# ab16502)
or PPARγ(Cat#: ab178860), and amplification of promoter sequences from
the Nr1h3 (LXRα), Nr1h4 (FXR) and Bsep genes using specific primer sets
and subsequent PCR; After elution and purification, the chromatin DNA
was subjected to real time PCR analysis with primers, LXRα: forward: 5’-
aaggaagctcaggcacaaaa -3’ and reverse: 5’- gaggctgtgcttgtgaaaca -3’, FXR:
forward: 5’- ccactggagatccaaaagga -3’ and reverse: 5’-
aatctatgcaaagcgctggt -3’, Bsep primer sequences: forward: 5’-
tccaaattggtccacagtga -3’ and reverse: 5’- agcagcagcctcctcattac -3’. The
levels of level of AST, ALT, γ-GT, and AP etc., were measured using a
commercial ELISA kit (Abcam) according to the manufacturer’s protocol.