Subunit Gene MW Sequence Fragment length PCR program
Main genes Main genes Main genes Main genes Main genes Main genes
PsbA D1 39 F: AATAGGGAACCGCCGAATAC 220 One cycle of initial denaturation at 95 °C for 15 min, 45 cycles of amplification at 95°C for 30 s, 60 °C for 45 s, 72 °C for 45 s, and ultimately 72 °C for 10 min.
R: GTATGCGTCCTTGGATTGCT
PsbS CP22 22 F: CTCAGCCCAAAGTTCACCAT 175 One cycle of initial denaturation at 95 °C for 15 min, 45 cycles of amplification at 95°C for 30 s, 60 °C for 45 s, 72 °C for 45 s, and ultimately 72 °C for 10 min.
R: CCACCAGACGTTCCAAAGAT
Internal control Internal control Internal control Internal control Internal control Internal control
RID2 18S rRNA 32 F: GAGAAACGGCTACCACATCCA 252 One cycle of initial denaturation at 95 °C for 15 min, 45 cycles of amplification at 95°C for 30 s, 60 °C for 45 s, 72 °C for 45 s, and ultimately 72 °C for 10 min.
R: CCCAACCCAAGGTCCAACTAC