2.1 Study area and specimen collection
Fish samples were collected from marine and coastal habitats, fish
landing centers, fish markets or from the local fishermen from July 2015
to June 2019. Most of the specimens were collected from the Cox’s Bazar
and Patuakhali regions. At least three specimens were collected for each
species. In case of rare ones single specimen were analyzed. Personal
fishing was also conducted to collect some rare and non-commercial fish
species whenever necessary. Digital photographs of all the fishes were
taken immediately and taxonomic identification of specimens was done
following previous reports (Talwar and Jhingran, 1991; Rahman et al.,
2009; Siddiqui et al., 2007; Nakabo, 2002; Carpenter et al., 2002a,
2002b; Last et al., 2016). Immediately after collecting the specimens,
tissue samples were excised and stored in 90% ethanol. Voucher
specimens were fixed with 10% formalin and then transferred to 70%
ethanol solution for preservation. Voucher specimens were transported to
Dhaka and deposited in the Dhaka University Zoology Museum (DUZM).
DNA barcoding
DNA was isolated from muscle sample using the QIAGEN DNeasy Blood &
Tissue Kit following the manufacturer’s protocol, under sterile
condition. The concentration of the isolated DNA was measured in
NanoDrop™ spectrophotometer to evaluate its quality and quantity. A 658
bp long fragment from the 5′ region of the COI gene was PCR-amplified by
the primer pair FishF2 5′TCGACTAATCATAAAGATATCGGCAC3′ and FishR2
5′ACTTCAGGGTGACCGAAGAATCAGAA3′. The primer pair FishF1
5′TCAACCAACCACAAAGACATTGGCAC3′ and FishR1 5′TAGACTTCTGGGTGGCCAAAGAATCA3′
were used for the amplification of COI that failed to amplify using
FishF2/FishR2. The PCR amplification of each sample was conducted in a
25 µl volume comprised of 23 µl of PCR Master Mix and 2 µl of template
DNA that was subsequently spun for 30 seconds for homogenization. The
components of the PCR Master Mix were as such: 12.5 µl Taq Polymerase,
8.5 µl Nano Pure water, 1 µl forward primer and 1 µl reverse primer. The
PCR amplification was carried out in the ASTEC Thermal Cycler GeneAtlas
(Astec Co. Ltd.) where the thermocycling profile was customized as such:
an initial denaturation at 95℃ for 5 minutes followed by 41 cycles of
denaturation at 95℃ for 30 s, primer annealing at 54℃ for 30 seconds,
extension for 72℃ for 1 minute, and a final extension at 72℃ for 5
minutes. The PCR products were kept at room temperature for 15 minutes,
and preserved afterward at -20℃ until further downstream application.
The amplicons were further identified through electrophoresis in a 1%
agarose gel. Then they were purified using PureLink™ PCR purification
kit. The good quality amplicons were then parceled for sequencing to the
First BASE laboratories, Malaysia where they conducted the Sanger’s
dideoxy sequencing using ABI PRISM 3730xl Genetic Analyzer exploiting
the BigDye® Terminator v3.1 cycle sequencing kit chemistry. The
assembled contigs were prepared by the CAP3 DNA assembly program. These
newly obtained sequences were uploaded in the BLASTn suite to check
whether they meet the threshold value of ≥ 97% for both the percent
identity and query coverage. The sequences of the high-fidelity
amplicons were then deposited in the GenBank with the help of the
Barcode Submission Tool with detailed source information and feature
annotation.