Sequencing and alignment of γECS mutants
Genomic DNA was isolated from the shoots of Col-0, cad2-1 ,pad2-1 and rax1-1 plants using the illustra DNA Extraction Kit PHYTOPURE (GE Healthcare Life Sciences), and DNA concentration was measured in a NanoDrop ND-1000 spectrophotometer (Thecnologies Inc., Wilmington, DE, USA). A 637 bp fragment of gene GSH1 (γ-glutamylcysteine synthetase, γ-ECS) was amplified by PCR using primers γECS01F (CGTTCGGATTATTTCTTGGTGT) and γECS02R (GCGGTCCTTGTCAGTGTCTGT), and sequenced in an ABI Prism® 3730/3730xl DNA Sequencer (Certified Scientific Instruments, Inc., USA). Sequences were revised and aligned using the Geneious Pro 5.5.3 software in comparison with GSH1 gene sequence (AT4G23100), and the identity of each mutant was verified as described in literature (Supplementary Fig. 1).