Sequencing and alignment of γECS mutants
Genomic DNA was isolated from the shoots of Col-0, cad2-1 ,pad2-1 and rax1-1 plants using the illustra DNA Extraction
Kit PHYTOPURE (GE Healthcare Life Sciences), and DNA concentration was
measured in a NanoDrop ND-1000 spectrophotometer (Thecnologies Inc.,
Wilmington, DE, USA). A 637 bp fragment of gene GSH1 (γ-glutamylcysteine
synthetase, γ-ECS) was amplified by PCR using primers γECS01F
(CGTTCGGATTATTTCTTGGTGT) and γECS02R (GCGGTCCTTGTCAGTGTCTGT), and
sequenced in an ABI Prism® 3730/3730xl DNA Sequencer (Certified
Scientific Instruments, Inc., USA). Sequences were revised and aligned
using the Geneious Pro 5.5.3 software in comparison with GSH1 gene
sequence (AT4G23100), and the identity of each mutant was verified as
described in literature (Supplementary Fig. 1).